The result is the following gene with fifty-two bases:ĬAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC Thus, the gene is created by the following associations between genetic bases and binary digits: In 8-bit ASCII, the letter C, for example, is: 01000011.
Deep blue chess game move by move code#
The "Cartesian gene" was produced according to a new code I created especially for the work. The "Cartesian gene" was coupled with a gene that causes this sculptural mutation in the plant, so that the public can see with the naked eye that the "Cartesian gene" is expressed precisely where the curls develop and twist. Through genetic modification, the leaves of the plants curl. The gene uses ASCII (the universal computer code for representing binary numbers as Roman characters, on- and off-line) to translate Descartes's statement: "Cogito ergo sum" (I think therefore I am) into the four bases of genetics. Positioned exactly where Deep Blue made its Move 36 is a plant whose genome incorporates a new gene that I created specifically for this work. The installation presents a chessboard made of earth (dark squares) and white sand (light squares) in the middle of the room. Kasparov could not believe that a machine had made such a keen move. Rather than making a move expected by viewers and commentators alike-a sound move that would have afforded immediate gratification-it made a move that was subtle and conceptual and, in the long run, better. The installation sheds light on the limits of the human mind and the increasing capabilities developed by computers and robots, inanimate beings whose actions often acquire a force comparable to subjective human agency.Īccording to Kasparov, Deep Blue's quintessential moment in game two came at Move 36. This competition may be characterized as a match between the greatest chess player who ever lived and the greatest chess player who never lived. "Move 36" makes reference to the dramatic move made by the computer called Deep Blue against chess world champion Gary Kasparov in 1997.